Please use this identifier to cite or link to this item: http://repositorio.unicamp.br/jspui/handle/REPOSIP/99846
Type: Artigo de periódico
Title: Frequency Of The Cystic Fibrosis Delta F 508 Mutation In A Population From São Paulo State, Brazil.
Author: Martins C.S.
Ribeiro F.
Costa F.F.
Abstract: Cystic fibrosis (CF) nonrelated patients (N = 24) from São Paulo State, Brazil, were screened for the presence of the delta F 508 mutation by PCR amplification of the deletion region with the primers C16B (5'GTTTTCCTGGATTATGCCTGGGCAC3') and C16D (5'GTTGGCATGCTTTGATGACGCTTC 3'), and by acrylamide gel electrophoresis. The allelic frequency of the delta F 508 mutation was 33% (15/48 chromosomes). The genotype distribution among the patients showed 12.5% (N = 3) of delta F 508 homozygotes, 37.5% (N = 9) of delta F heterozygotes and 50% (N = 12) of non-carriers of the mutation. The frequency observed in this study is lower than that estimated for the North American and North European population (75% to 80%) and is similar to that described in Southern Europe (25% to 50%) which is consistent with the origins of this population.
Editor: 
Rights: aberto
Identifier DOI: 
Address: http://www.scopus.com/inward/record.url?eid=2-s2.0-0027674061&partnerID=40&md5=9404546ca02e11f8f6e921f111254676
Date Issue: 1993
Appears in Collections:Unicamp - Artigos e Outros Documentos

Files in This Item:
There are no files associated with this item.


Items in DSpace are protected by copyright, with all rights reserved, unless otherwise indicated.