Please use this identifier to cite or link to this item: http://repositorio.unicamp.br/jspui/handle/REPOSIP/67184
Type: Artigo de periódico
Title: FREQUENCY OF THE CYSTIC-FIBROSIS DELTA-F-508 MUTATION IN A POPULATION FROM SAO-PAULO STATE, BRAZIL
Author: MARTINS, CSB
RIBEIRO, F
COSTA, FF
Abstract: Cystic fibrosis (CF) nonrelated patients (N = 24) from Sao Paulo State, Brazil, were screened for the presence of the DELTAF 508 mutation by PCR amplification of the deletion region with the primers C16B(5'GTTTTCCTGGATTATGCCTGGGCAC3') and C16D (5'GTTGGCATGCTTTGAT-GACGCTTC3') and by acrylamide gel electrophoresis.The allelic frequency of the DELTAF 508 mutation was 33 % (15/48 chromosomes). The genotype distribution among the patients showed 12.5 % (N = 3) of DELTAF 508 homozygotes, 37.5 % (N = 9) of DELTAF heterozygotes and 50 % (N = 12) of non-carriers of the mutation. The frequency observed in this study is lower than that estimated for the North American and North European population (75 % to 80 %) and is similar to that described in Southern Europe (25 % to 50 %) which is consistent with the origins of this population.
Subject: CYSTIC FIBROSIS
MUTATION DELTA-F-508
PCR
CHROMOSOME-7
SWEAT ELECTROLYTES
Country: Brasil
Editor: Assoc Bras Divulg Cientifica
Rights: aberto
Date Issue: 1993
Appears in Collections:Artigos e Materiais de Revistas Científicas - Unicamp

Files in This Item:
There are no files associated with this item.


Items in DSpace are protected by copyright, with all rights reserved, unless otherwise indicated.