Please use this identifier to cite or link to this item:
Type: Artigo de periódico
Title: Histopathological Events And Detection Of Metarhizium Anisopliae Using Specific Primers In Infected Immature Stages Of The Fruit Fly Anastrepha Fraterculus (wiedemann, 1830) (diptera: Tephritidae).
Author: Bechara, I J
Destéfano, R H R
Bresil, C
Messias, C L
Abstract: The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Subject: Animals
Dna Primers
Dna, Fungal
Pest Control, Biological
Polymerase Chain Reaction
Rights: aberto
Identifier DOI: 
Date Issue: 2011
Appears in Collections:Unicamp - Artigos e Outros Documentos

Files in This Item:
File SizeFormat 
pmed_21437404.pdf2.15 MBAdobe PDFView/Open

Items in DSpace are protected by copyright, with all rights reserved, unless otherwise indicated.